ID: 1125450192_1125450201

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125450192 1125450201
Species Human (GRCh38) Human (GRCh38)
Location 15:39799845-39799867 15:39799866-39799888
Sequence CCCTCCCTCTTCTACCCAGTCTG TGGCTCTACAACGACAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 822} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!