ID: 1125452778_1125452782

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1125452778 1125452782
Species Human (GRCh38) Human (GRCh38)
Location 15:39826360-39826382 15:39826393-39826415
Sequence CCACTTCTGGAACAAGGTTGAGA TGGAGTAAAGACAGGACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132} {0: 1, 1: 0, 2: 2, 3: 8, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!