ID: 1125466978_1125466984

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1125466978 1125466984
Species Human (GRCh38) Human (GRCh38)
Location 15:39963011-39963033 15:39963052-39963074
Sequence CCTTCCTCTTTAAGGAGATACAA AGGAAGCAGCCAGCAGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 221} {0: 1, 1: 1, 2: 4, 3: 66, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!