ID: 1125505292_1125505303

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1125505292 1125505303
Species Human (GRCh38) Human (GRCh38)
Location 15:40264620-40264642 15:40264653-40264675
Sequence CCATTTCCCTGAGGAAGCAGAGA GGGAAGCCCTAGGCTTCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 468} {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!