ID: 1125538340_1125538345

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1125538340 1125538345
Species Human (GRCh38) Human (GRCh38)
Location 15:40455640-40455662 15:40455676-40455698
Sequence CCAGCCGCCTTCTCCTTACTCTG TCCTCAAAGACGACAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 314} {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!