ID: 1125584507_1125584511

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1125584507 1125584511
Species Human (GRCh38) Human (GRCh38)
Location 15:40810519-40810541 15:40810539-40810561
Sequence CCTACTTGATTATGTGGGCCCTG CTGGATCCCTCTCCTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 2, 3: 43, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!