ID: 1125598018_1125598028

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1125598018 1125598028
Species Human (GRCh38) Human (GRCh38)
Location 15:40899823-40899845 15:40899865-40899887
Sequence CCTGCTGCTACTGGCAGACCGGG GACCGGGCAGGTGGTGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125} {0: 1, 1: 0, 2: 0, 3: 22, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!