ID: 1125717460_1125717479

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1125717460 1125717479
Species Human (GRCh38) Human (GRCh38)
Location 15:41827464-41827486 15:41827517-41827539
Sequence CCCCGACTTCCCACACCAGCCGC TCTGGGCCAGGTCCTTCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 279} {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!