ID: 1125717811_1125717815

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1125717811 1125717815
Species Human (GRCh38) Human (GRCh38)
Location 15:41829530-41829552 15:41829546-41829568
Sequence CCTTCCACCTCAGCATTCCAAAG TCCAAAGTTTTGGAACGCCATGG
Strand - +
Off-target summary {0: 2, 1: 77, 2: 2778, 3: 33356, 4: 94649} {0: 1, 1: 0, 2: 0, 3: 24, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!