ID: 1125722070_1125722077

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1125722070 1125722077
Species Human (GRCh38) Human (GRCh38)
Location 15:41849994-41850016 15:41850026-41850048
Sequence CCCAGACCATCTGCAGGCGCCAG CTCCTTCCTCCAGCTTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 150} {0: 1, 1: 2, 2: 25, 3: 199, 4: 935}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!