ID: 1125727059_1125727071

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1125727059 1125727071
Species Human (GRCh38) Human (GRCh38)
Location 15:41873554-41873576 15:41873601-41873623
Sequence CCAGCGGCCGCTTCTCCTCCACC AGAAAGTACTGCCAAGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 441} {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!