ID: 1125751974_1125751980

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1125751974 1125751980
Species Human (GRCh38) Human (GRCh38)
Location 15:42035455-42035477 15:42035487-42035509
Sequence CCTCGTTCTCCTGCTGGGAATGG CCATGCTTTCCCAGCGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203} {0: 1, 1: 0, 2: 1, 3: 1, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!