ID: 1125760829_1125760840

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1125760829 1125760840
Species Human (GRCh38) Human (GRCh38)
Location 15:42094437-42094459 15:42094486-42094508
Sequence CCCCCAGGTGACAGGCTCTCCAT CCCAGCCCTTGCCAAGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162} {0: 1, 1: 0, 2: 3, 3: 24, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!