ID: 1125787038_1125787044

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1125787038 1125787044
Species Human (GRCh38) Human (GRCh38)
Location 15:42328379-42328401 15:42328404-42328426
Sequence CCTTTACCAAAAATGTTTGCCAA CCTGCTTTAGATGGTTCTAAAGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 59, 3: 318, 4: 908} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!