ID: 1125811849_1125811855

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125811849 1125811855
Species Human (GRCh38) Human (GRCh38)
Location 15:42548696-42548718 15:42548731-42548753
Sequence CCACCGCTCAGCTGCCGTAAGGC GACCCAGGACCCGCAGTAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69} {0: 1, 1: 0, 2: 2, 3: 11, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!