ID: 1125828721_1125828724

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1125828721 1125828724
Species Human (GRCh38) Human (GRCh38)
Location 15:42696051-42696073 15:42696073-42696095
Sequence CCCTGCTCCTTCTGTTCATTCAT TTCAACAAATGTTTATTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 558} {0: 1, 1: 0, 2: 9, 3: 76, 4: 553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!