ID: 1125828721_1125828727

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1125828721 1125828727
Species Human (GRCh38) Human (GRCh38)
Location 15:42696051-42696073 15:42696095-42696117
Sequence CCCTGCTCCTTCTGTTCATTCAT GGTATTATTTTAGGATACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 558} {0: 1, 1: 0, 2: 2, 3: 20, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!