ID: 1125879996_1125880004

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1125879996 1125880004
Species Human (GRCh38) Human (GRCh38)
Location 15:43185532-43185554 15:43185555-43185577
Sequence CCCACCCTGGCTTCGCCTTTGGA GCAGCTCCGGCACTTGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 137} {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!