ID: 1125898006_1125898011

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1125898006 1125898011
Species Human (GRCh38) Human (GRCh38)
Location 15:43318724-43318746 15:43318767-43318789
Sequence CCAACAGTGGCCACAGGGATGTC TAGGCTAGAAAGTAGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 187} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!