ID: 1125916654_1125916657

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1125916654 1125916657
Species Human (GRCh38) Human (GRCh38)
Location 15:43493520-43493542 15:43493542-43493564
Sequence CCAGCTTTCTCATAACAGGGCAA AAGAAGAAGCGGCTTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143} {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!