ID: 1125930155_1125930158

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1125930155 1125930158
Species Human (GRCh38) Human (GRCh38)
Location 15:43594314-43594336 15:43594328-43594350
Sequence CCGACCGGAACCTGTACGAGCTG TACGAGCTGCCAGTGAACGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 37} {0: 2, 1: 0, 2: 0, 3: 0, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!