ID: 1125943323_1125943336

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1125943323 1125943336
Species Human (GRCh38) Human (GRCh38)
Location 15:43694146-43694168 15:43694199-43694221
Sequence CCGACCGGAACCTGTACGAGCTG GGTAACAGTGCCTGAGGCGCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 37} {0: 2, 1: 0, 2: 0, 3: 9, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!