ID: 1125957567_1125957575

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125957567 1125957575
Species Human (GRCh38) Human (GRCh38)
Location 15:43800771-43800793 15:43800806-43800828
Sequence CCAATCTGGAGACGGTAAGGTTG TCGGGGCGGGCTGAGAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 53} {0: 1, 1: 0, 2: 1, 3: 32, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!