ID: 1126024541_1126024552

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1126024541 1126024552
Species Human (GRCh38) Human (GRCh38)
Location 15:44433198-44433220 15:44433247-44433269
Sequence CCAGCCACTAGCGGGGCTGAGTA TGAGGCTGCAGTGAGCCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 1192} {0: 2, 1: 10, 2: 53, 3: 174, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!