ID: 1126105452_1126105460

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1126105452 1126105460
Species Human (GRCh38) Human (GRCh38)
Location 15:45144187-45144209 15:45144228-45144250
Sequence CCGTGGACGCCGCACTCTGCTGC ATGACCTGGTATGGCTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112} {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!