ID: 1126350751_1126350754

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1126350751 1126350754
Species Human (GRCh38) Human (GRCh38)
Location 15:47742683-47742705 15:47742698-47742720
Sequence CCTCTCTACCCAGCTTGGAATAG TGGAATAGATGCAGCCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253} {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!