ID: 1126351048_1126351055

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1126351048 1126351055
Species Human (GRCh38) Human (GRCh38)
Location 15:47745166-47745188 15:47745198-47745220
Sequence CCCTTCCTCACAGTTGTACCTTT CAGGCTTCCTGGTACTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 278} {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!