ID: 1126462378_1126462387

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1126462378 1126462387
Species Human (GRCh38) Human (GRCh38)
Location 15:48927540-48927562 15:48927593-48927615
Sequence CCACCACATGAAACCCCTGGCAT CCCCTAGACCCTGGGGTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 165} {0: 1, 1: 0, 2: 0, 3: 35, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!