ID: 1126503416_1126503425

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1126503416 1126503425
Species Human (GRCh38) Human (GRCh38)
Location 15:49374617-49374639 15:49374664-49374686
Sequence CCATCTAGGCTCCGCCTCCCAGG CTCCTGAGTATTGAGATTACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 151, 4: 1103} {0: 1, 1: 10, 2: 121, 3: 440, 4: 2398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!