ID: 1126544774_1126544780

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1126544774 1126544780
Species Human (GRCh38) Human (GRCh38)
Location 15:49861485-49861507 15:49861508-49861530
Sequence CCTACCTACCTACCTACCTCAGT CTCTCTCAGCATCACTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 25, 3: 590, 4: 906} {0: 1, 1: 0, 2: 1, 3: 16, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!