ID: 1126568860_1126568865

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1126568860 1126568865
Species Human (GRCh38) Human (GRCh38)
Location 15:50128529-50128551 15:50128561-50128583
Sequence CCCACTTCCCTCTACTGTCACAG GGTTCTCTGTGATGCCATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 291} {0: 1, 1: 0, 2: 1, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!