ID: 1126568860_1126568868

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1126568860 1126568868
Species Human (GRCh38) Human (GRCh38)
Location 15:50128529-50128551 15:50128577-50128599
Sequence CCCACTTCCCTCTACTGTCACAG ATTCTGGAGAGAAGCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 291} {0: 1, 1: 0, 2: 4, 3: 49, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!