ID: 1126572285_1126572289

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1126572285 1126572289
Species Human (GRCh38) Human (GRCh38)
Location 15:50164903-50164925 15:50164937-50164959
Sequence CCTACAATCACTGTGCTCTCCTC GACTCTTTCTCCATGCCATAAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 40, 3: 113, 4: 413} {0: 1, 1: 0, 2: 3, 3: 35, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!