ID: 1126689291_1126689295

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1126689291 1126689295
Species Human (GRCh38) Human (GRCh38)
Location 15:51275372-51275394 15:51275392-51275414
Sequence CCTCCAGCCCTACTCAGAGCTTT TTTTGCTTTACTAAGACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 274} {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!