ID: 1126746942_1126746944

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1126746942 1126746944
Species Human (GRCh38) Human (GRCh38)
Location 15:51835764-51835786 15:51835795-51835817
Sequence CCAACCTCATTATTCTTATGTAG ACTTTTCCTCATTTCTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227} {0: 1, 1: 0, 2: 5, 3: 47, 4: 507}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!