ID: 1126779981_1126779983

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1126779981 1126779983
Species Human (GRCh38) Human (GRCh38)
Location 15:52131119-52131141 15:52131133-52131155
Sequence CCCAGCTGAGTGTGTGCATTTTA TGCATTTTAAAGCTGTACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 521} {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!