ID: 1126814204_1126814209

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1126814204 1126814209
Species Human (GRCh38) Human (GRCh38)
Location 15:52438858-52438880 15:52438889-52438911
Sequence CCGTCCACCACTGCTGTTTGCCA GACCTGTGGCTGACTTCCACAGG
Strand - +
Off-target summary {0: 41, 1: 78, 2: 97, 3: 99, 4: 296} {0: 1, 1: 1, 2: 1, 3: 7, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!