ID: 1126814204_1126814212

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1126814204 1126814212
Species Human (GRCh38) Human (GRCh38)
Location 15:52438858-52438880 15:52438893-52438915
Sequence CCGTCCACCACTGCTGTTTGCCA TGTGGCTGACTTCCACAGGGTGG
Strand - +
Off-target summary {0: 41, 1: 78, 2: 97, 3: 99, 4: 296} {0: 1, 1: 0, 2: 6, 3: 112, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!