ID: 1126845727_1126845730

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1126845727 1126845730
Species Human (GRCh38) Human (GRCh38)
Location 15:52759040-52759062 15:52759064-52759086
Sequence CCCCTATGTAGGCGTTCTAGAGC GCCACTGCCACCTTTATATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24} {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!