ID: 1126937303_1126937305

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1126937303 1126937305
Species Human (GRCh38) Human (GRCh38)
Location 15:53725315-53725337 15:53725361-53725383
Sequence CCGGGATGTGGAGCAACAGGAAT GCAAAATAGGACAGCCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 19, 3: 72, 4: 342} {0: 1, 1: 40, 2: 393, 3: 1123, 4: 3423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!