ID: 1127077655_1127077661

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1127077655 1127077661
Species Human (GRCh38) Human (GRCh38)
Location 15:55343715-55343737 15:55343762-55343784
Sequence CCATCCTCTGTCTACTTAGAAGG AAACCCCTTGATCTCCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 240} {0: 1, 1: 0, 2: 0, 3: 13, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!