ID: 1127132663_1127132668

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1127132663 1127132668
Species Human (GRCh38) Human (GRCh38)
Location 15:55883281-55883303 15:55883300-55883322
Sequence CCACGGAGAGACTCTGCCTGTGG GTGGAAAGAGAAGGGAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175} {0: 1, 1: 12, 2: 106, 3: 467, 4: 2261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!