ID: 1127134861_1127134868

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1127134861 1127134868
Species Human (GRCh38) Human (GRCh38)
Location 15:55909626-55909648 15:55909649-55909671
Sequence CCAAGCCCCTTCAGCCTACAAAG CCTCTTGTCCTGGCTTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 245} {0: 1, 1: 1, 2: 4, 3: 50, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!