ID: 1127173563_1127173571

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1127173563 1127173571
Species Human (GRCh38) Human (GRCh38)
Location 15:56328860-56328882 15:56328901-56328923
Sequence CCACCCTGAAGAGAAGGACAGAC CCTGCTGATTGTAGAGTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 124, 4: 383} {0: 10, 1: 74, 2: 265, 3: 469, 4: 938}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!