ID: 1127209992_1127209995

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1127209992 1127209995
Species Human (GRCh38) Human (GRCh38)
Location 15:56764303-56764325 15:56764350-56764372
Sequence CCTGCTATACACTCATAGATGTT GTTGTTTTGGTTTTGGTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 2, 1: 14, 2: 72, 3: 653, 4: 2610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!