ID: 1127270081_1127270088

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1127270081 1127270088
Species Human (GRCh38) Human (GRCh38)
Location 15:57392639-57392661 15:57392686-57392708
Sequence CCTTCTGTTCATCATCTGTCTCC CTGGATAATAAAGCTGTATAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 482} {0: 1, 1: 1, 2: 1, 3: 8, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!