ID: 1127295321_1127295323

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1127295321 1127295323
Species Human (GRCh38) Human (GRCh38)
Location 15:57604141-57604163 15:57604156-57604178
Sequence CCTGTATGATCAGGACAGTGTTC CAGTGTTCCCCAATGGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!