ID: 1127334115_1127334122

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1127334115 1127334122
Species Human (GRCh38) Human (GRCh38)
Location 15:57966866-57966888 15:57966904-57966926
Sequence CCCTGGGAACCTAACCTACAACA GGAGAGCACATATCACTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 168} {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!