ID: 1127346922_1127346926

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1127346922 1127346926
Species Human (GRCh38) Human (GRCh38)
Location 15:58110308-58110330 15:58110324-58110346
Sequence CCAAAGGGAGAAGCAAATGGAGA ATGGAGAAGGTGAGGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 427} {0: 1, 1: 1, 2: 8, 3: 70, 4: 744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!