ID: 1127410215_1127410221

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1127410215 1127410221
Species Human (GRCh38) Human (GRCh38)
Location 15:58697763-58697785 15:58697793-58697815
Sequence CCACCTGGACCTGCTAACACCAG ATATGTTGCCCTAAGGCCCAAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 17, 3: 35, 4: 174} {0: 1, 1: 0, 2: 4, 3: 25, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!